
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nprl2
- Ensembl ID:
- ENSDARG00000059613
- ZFIN ID:
- ZDB-GENE-060825-93
- Description:
- tumor suppressor candidate 4 [Source:RefSeq peptide;Acc:NP_001039312]
- Human Orthologue:
- NPRL2
- Human Description:
- nitrogen permease regulator-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:24969]
- Mouse Orthologue:
- Nprl2
- Mouse Description:
- nitrogen permease regulator-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914482]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18351 | Nonsense | Available for shipment | Available now |
sa25337 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18351
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083038 | Nonsense | 26 | 379 | 1 | 11 |
The following transcripts of ENSDARG00000059613 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 24053321)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 20308767 GRCz11 6 22368989 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTATATTTTTYAGTGAATTTCATCCAACGTTAGGACCAAAGATCACATAT[C/T]AGGTAACATCACAGAAACCWGTATTTGGGAACARATGWATGTTTGGCWGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25337
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083038 | Essential Splice Site | 240 | 379 | 7 | 11 |
The following transcripts of ENSDARG00000059613 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 24039458)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 20294904 GRCz11 6 22355126 - KASP Assay ID:
- 554-7420.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTTTTACAGGTATTATGACGTGGTAACTCTGGTATCCATATTTCAGG[T/C]ATGTTTTTTTGTTGATGTTGTTTATTCTCATTCTTGTAATGGGTTCTTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: