si:dkey-46l15.1

Ensembl ID:
ENSDARG00000059604
ZFIN ID:
ZDB-GENE-081105-141
Description:
hypothetical protein LOC560131 [Source:RefSeq peptide;Acc:NP_001116724]
Human Orthologues:
MTSS1, MTSS1L
Human Descriptions:
metastasis suppressor 1 [Source:HGNC Symbol;Acc:20443]
metastasis suppressor 1-like [Source:HGNC Symbol;Acc:25094]
Mouse Orthologues:
Mtss1, Mtss1l
Mouse Descriptions:
metastasis suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2384818]
metastasis suppressor 1-like Gene [Source:MGI Symbol;Acc:MGI:3039591]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11667 Nonsense Available for shipment Available now
sa40790 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31543 Nonsense Available for shipment Available now
sa20818 Essential Splice Site Available for shipment Available now
sa33966 Nonsense Mutation detected in F1 DNA During 2018
sa20817 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083007 Nonsense 12 693 1 14
ENSDART00000134146 Nonsense 12 702 1 15
Genomic Location (Zv9):
Chromosome 6 (position 50636437)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50685915
GRCz11 6 50685134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGGGCTGGTAAAATGGATGCGGGAATGGAGAAGGAGTGCAGYGCTT[T/A]GGGAGGGCTCTTCCAAATCATCATGAACGACATGAAGGTGAGTCCCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083007 Essential Splice Site 342 693 11 14
ENSDART00000134146 Essential Splice Site 342 702 11 15
Genomic Location (Zv9):
Chromosome 6 (position 50541878)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50591356
GRCz11 6 50590575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACAGCGGGCATGAGGAGAGAGTCAGGACACTGTCCTCCTCGGGCAAG[G/A]TACAGGATCATTTTATTGCAATAATGATGCACTGTTTTCTTACTTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083007 Nonsense 344 693 12 14
ENSDART00000134146 Nonsense 344 702 12 15
Genomic Location (Zv9):
Chromosome 6 (position 50539073)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50588551
GRCz11 6 50587770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATCGATCTTCCAAATAGTGATTGGCTTTTTTCCGCTGTGTGTAGCCA[C/T]AGTCAGCTCGAGAGCAGCTGGCTCTTACTCTAGGAGGAGGACTTAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083007 Essential Splice Site 395 693 12 14
ENSDART00000134146 Essential Splice Site 395 702 12 15
Genomic Location (Zv9):
Chromosome 6 (position 50538918)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50588396
GRCz11 6 50587615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACCACCACGCCATCCTGCTCTGAAGACACCATCCCGTCACAGCACGG[T/G]CAGTACACACATGCTGAATACACACACATGCATGATTGAGACAATTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083007 Nonsense 505 693 14 14
ENSDART00000134146 Nonsense 514 702 15 15
Genomic Location (Zv9):
Chromosome 6 (position 50533855)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50583333
GRCz11 6 50582552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCGTCCATTTCTACCGCTGGCCTGAGTGGCAGTGATGACATCACATG[T/A]CCTCCTGGAGTGACCCAAAGCAACAGAGTGCCCGGCTCCGATTTAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083007 Nonsense 691 693 14 14
ENSDART00000134146 Nonsense 700 702 15 15
Genomic Location (Zv9):
Chromosome 6 (position 50533297)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50582775
GRCz11 6 50581994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAGGACACTTACCAACGATCGTTCGGCGCCTTTAATCACGCCTAACTA[T/A]CTCAATTGATTCAATTTTTTTTCGTTGAATTCGTCTGTGGCTTTTTTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link