
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rabep1
- Ensembl ID:
- ENSDARG00000059600
- ZFIN ID:
- ZDB-GENE-060526-165
- Description:
- rab GTPase-binding effector protein 1 [Source:RefSeq peptide;Acc:NP_001116759]
- Human Orthologue:
- RABEP1
- Human Description:
- rabaptin, RAB GTPase binding effector protein 1 [Source:HGNC Symbol;Acc:17677]
- Mouse Orthologue:
- Rabep1
- Mouse Description:
- rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI Symbol;Acc:MGI:1860236]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15851 | Nonsense | Available for shipment | Available now |
sa14919 | Nonsense | Available for shipment | Available now |
sa20551 | Nonsense | Available for shipment | Available now |
sa11256 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15851
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110182 | Nonsense | 540 | 850 | 10 | 18 |
- Genomic Location (Zv9):
- Chromosome 5 (position 60758821)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 58390948 GRCz11 5 59060657 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTGCTCTAATTAYGAGAAACAACTGCAGGTYATCCAGGGACAAGAGGCC[G/T]AGACACGAGAKCAGGTTGGTGCTTCTAYGGCTTCAAAAWCAGGTCTYTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14919
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110182 | Nonsense | 615 | 850 | 12 | 18 |
- Genomic Location (Zv9):
- Chromosome 5 (position 60761294)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 58393421 GRCz11 5 59063130 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGCGCTCTMCAACAGGCCTTYAGYCAGGCCAAGAGGAAYACCCAGGAA[C/T]AGATGGTACMAGCAAAAACACTYACTCATTTTGCTTCATTAATTTCAACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20551
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110182 | Nonsense | 738 | 850 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 5 (position 60770063)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 58402190 GRCz11 5 59071899 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTCTTCCATCCTGTAGCATCTTTTTCCAGCCTAAAGACGGAACTGGAA[C/T]GAGTGAAGAGTGAGAAGGAACAGGTAGGAAAGAACACAGATATGCAAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11256
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110182 | Essential Splice Site | 817 | 850 | 17 | 18 |
- Genomic Location (Zv9):
- Chromosome 5 (position 60775644)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 58407771 GRCz11 5 59077480 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGCGAGCAGGTCCAGAGAGATTTYGTCAAACTGTCCCAGACCCTTCAG[G/A]TAAATGYATTTMACTAGAAATTAAACCACAGTTTCATTTCTACACGGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: