zgc:153652

Ensembl ID:
ENSDARG00000059598
ZFIN ID:
ZDB-GENE-061013-517
Description:
hypothetical protein LOC768149 [Source:RefSeq peptide;Acc:NP_001070760]
Human Orthologue:
SAMD1
Human Description:
sterile alpha motif domain containing 1 [Source:HGNC Symbol;Acc:17958]
Mouse Orthologue:
Samd1
Mouse Description:
sterile alpha motif domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2142433]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12607 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126960 Essential Splice Site 114 377 1 7
Genomic Location (Zv9):
Chromosome 3 (position 50607631)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45302051
GRCz11 3 49447462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAGCGCGCAGKGTCCCGTGGATGAGGATCACATGGAGGACATGGAAG[T/A]AAGTAAAGCGAGCGCTGCTTTTGCTGGAGTGAYGGGCAAGAAAACGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link