
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153652
- Ensembl ID:
- ENSDARG00000059598
- ZFIN ID:
- ZDB-GENE-061013-517
- Description:
- hypothetical protein LOC768149 [Source:RefSeq peptide;Acc:NP_001070760]
- Human Orthologue:
- SAMD1
- Human Description:
- sterile alpha motif domain containing 1 [Source:HGNC Symbol;Acc:17958]
- Mouse Orthologue:
- Samd1
- Mouse Description:
- sterile alpha motif domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2142433]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12607 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12607
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126960 | Essential Splice Site | 114 | 377 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 50607631)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 45302051 GRCz11 3 49447462 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGACAGCGCGCAGKGTCCCGTGGATGAGGATCACATGGAGGACATGGAAG[T/A]AAGTAAAGCGAGCGCTGCTTTTGCTGGAGTGAYGGGCAAGAAAACGAATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: