A8WFU3_DANRE

Ensembl ID:
ENSDARG00000059587
Description:
LOC560371 protein [Source:UniProtKB/TrEMBL;Acc:A8WFU3]
Human Orthologue:
ABR
Human Description:
active BCR-related gene [Source:HGNC Symbol;Acc:81]
Mouse Orthologue:
Abr
Mouse Description:
active BCR-related gene Gene [Source:MGI Symbol;Acc:MGI:107771]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40584 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082965 Nonsense 223 399 7 11
Genomic Location (Zv9):
Chromosome 5 (position 65586946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61863460
GRCz11 5 62526197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGTTAAACGATCTGTGTTTGTGTGTGTGTTTCTCAGGCGGCATCAG[C/T]AGTATGAGTGTAAATGGTACATTCCTCTGGCTGATCTGAGCTTTCAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link