wbscr16

Ensembl ID:
ENSDARG00000059583
ZFIN ID:
ZDB-GENE-060526-370
Description:
Williams-Beuren syndrome chromosome region 16 [Source:RefSeq peptide;Acc:NP_001076272]
Human Orthologue:
WBSCR16
Human Description:
Williams-Beuren syndrome chromosome region 16 [Source:HGNC Symbol;Acc:14948]
Mouse Orthologue:
Wbscr16
Mouse Description:
Williams-Beuren syndrome chromosome region 16 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:213760

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7012 Nonsense Mutation detected in F1 DNA During 2018
sa2219 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa7012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082952 Nonsense 43 451 2 12
Genomic Location (Zv9):
Chromosome 5 (position 64491633)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60744293
GRCz11 5 61429014
KASP Assay ID:
554-4394.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCMCTAAGAAGCGGGAWCAGCAGGACGACGTACCTGTGTATCAGTA[T/G]KTGGGTCAAAACAGGAAGCCYCAAGGGAARGTGTTTGTGTGGGGCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2219
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082952 Essential Splice Site 250 451 8 12
Genomic Location (Zv9):
Chromosome 5 (position 64477282)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60729942
GRCz11 5 61414663
KASP Assay ID:
554-2756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAACCATGTGACCCTTCCCACARTGTTTTAATGCWTCTCTTATTTTC[A/G]GGTCTGGGTCATCATAACAAGGCCTCGTGTCCAGTGCCTGTAGGWGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link