zgc:158337

Ensembl ID:
ENSDARG00000059582
ZFIN ID:
ZDB-GENE-061215-96
Description:
ankyrin repeat domain 57 [Source:RefSeq peptide;Acc:NP_001073475]
Human Orthologue:
ANKRD57
Human Description:
ankyrin repeat domain 57 [Source:HGNC Symbol;Acc:26149]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20600 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082955 Nonsense 103 438 1 1
Genomic Location (Zv9):
Chromosome 6 (position 22347)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50549
GRCz11 6 68600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGATGACCCTGCACCGGCAGCACGGGCCCGGACGCTCAGCTCAGGTTA[C/A]GGAACTGCTGATGCTGGAGGCGCAGAAACACACCCGCATATTTCTGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link