uhmk1

Ensembl ID:
ENSDARG00000059575
ZFIN ID:
ZDB-GENE-060929-1014
Description:
serine/threonine-protein kinase Kist [Source:RefSeq peptide;Acc:NP_001070127]
Human Orthologue:
UHMK1
Human Description:
U2AF homology motif (UHM) kinase 1 [Source:HGNC Symbol;Acc:19683]
Mouse Orthologue:
Uhmk1
Mouse Description:
U2AF homology motif (UHM) kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1341908]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33894 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082940 Nonsense 425 430 8 8
Genomic Location (Zv9):
Chromosome 6 (position 34685952)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35077535
GRCz11 6 35060918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTGGTCGCTACATTTTACCCACTGAGTGCCTATAAGAGAGGTTACT[T/A]ATACCAAACTGTGCAGTAAGGCTGCACACACACACACACACACACACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link