Q08CN5_DANRE

Ensembl ID:
ENSDARG00000059571
Description:
LOC558626 protein [Source:UniProtKB/TrEMBL;Acc:Q08CN5]
Human Orthologue:
DENND4C
Human Description:
DENN/MADD domain containing 4C [Source:HGNC Symbol;Acc:26079]
Mouse Orthologue:
Dennd4c
Mouse Description:
DENN/MADD domain containing 4C Gene [Source:MGI Symbol;Acc:MGI:1914769]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1910 Nonsense Available for shipment Available now
sa13987 Nonsense Available for shipment Available now
sa21119 Nonsense Mutation detected in F1 DNA During 2018
sa16852 Nonsense Available for shipment Available now
sa38651 Nonsense Mutation detected in F1 DNA During 2018
sa41064 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082930 Nonsense 28 633 2 16
ENSDART00000114722   87 1942 1 33
Genomic Location (Zv9):
Chromosome 7 (position 65638624)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58820364
GRCz11 7 59122794
KASP Assay ID:
554-1900.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAATCTCAACCATGGCAGCCTCAAGAGCCCAGAACTCTTCCTRTGTTA[C/T]AAGAGGGGTCGAGGGAAGCCCCCGCTCATTGACATTGGGTGAGTTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082930 Nonsense 384 633 11 16
ENSDART00000114722 Nonsense 444 1942 9 33
Genomic Location (Zv9):
Chromosome 7 (position 65621689)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58803429
GRCz11 7 59105859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTCATTATTATTTCCTTCTAGATGATCTTCCCCTTCCAGTGGCAATR[T/A]CCATATATTCCTCTTTGCCCTCTGTCTTTGGCGGGGGTTCTCAATGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082930 Nonsense 427 633 11 16
ENSDART00000114722 Nonsense 487 1942 9 33
Genomic Location (Zv9):
Chromosome 7 (position 65621561)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58803301
GRCz11 7 59105731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATACTTTGACCTCTACGATCCCCCTCCTGACGTAGTGTGTGTGGACT[T/A]GGACACCAACACTATATATTTGTGAGCACTCTTGAACATTTTGAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082930   None 633 None 16
ENSDART00000114722 Nonsense 860 1942 17 33
Genomic Location (Zv9):
Chromosome 7 (position 65609771)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58791511
GRCz11 7 59093941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATGAAAAAGGCWGGAGTTGAACCCAATGCTATTACTTATGGATACTA[C/A]AACAAGGTATGGAAATTCTCACTAGTTTAAAGTGGACTACAGCACTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082930   None 633 None 16
ENSDART00000114722 Nonsense 869 1942 18 33
Genomic Location (Zv9):
Chromosome 7 (position 65607311)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58789051
GRCz11 7 59091481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCTGTATATGATTCTGCATTGTCCAGGCTGTTCTGGAAAGTCCTTG[G/A]CCAAGCCGCAACCGTAGCGGTCTCTTCATGTGGACCAAAATGAGGAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082930   None 633 None 16
ENSDART00000114722 Nonsense 1819 1942 30 33
Genomic Location (Zv9):
Chromosome 7 (position 65592432)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58774172
GRCz11 7 59076602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTGGGATAATGTCAACTTACATCAGGAGCCCACCGAGCCCCTCTAT[C/T]AGCTCTGGAGGACCTTCTGTGAGTAACTTTTGAGAATTATTTGTTCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link