si:dkeyp-117b8.1

Ensembl ID:
ENSDARG00000059553
ZFIN ID:
ZDB-GENE-060526-361
Description:
Novel protein similar to vertebrate symplekin (SYMPK) [Source:UniProtKB/TrEMBL;Acc:A2CET0]
Human Orthologue:
SYMPK
Human Description:
symplekin [Source:HGNC Symbol;Acc:22935]
Mouse Orthologues:
AC148019.2, Sympk
Mouse Description:
symplekin Gene [Source:MGI Symbol;Acc:MGI:1915438]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20564 Nonsense Available for shipment Available now
sa11725 Nonsense Available for shipment Available now
sa9377 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082879 Nonsense 116 1108 5 24
ENSDART00000132452 Nonsense 90 1223 6 27
Genomic Location (Zv9):
Chromosome 5 (position 64928200)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61203690
GRCz11 5 61866427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACAATGAGCTTCTGCTGCGGCTGATTGCCAACCTGAACATGCTGATG[C/T]GAGATGAGAGCGTGAACGTGGTGAAAAAGGCCATTCTGACACTCACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082879 Nonsense 684 1108 14 24
ENSDART00000132452 Nonsense 658 1223 15 27
Genomic Location (Zv9):
Chromosome 5 (position 64937470)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61212960
GRCz11 5 61875697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTTGGAGGCTCCGATCATYACAGATTCAGCACTGGAGGTCATTCAG[C/T]GATACTGYGAGGACGAGGTCTGCAACATCCATACACTCCCATTTCTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082879 Essential Splice Site 777 1108 17 24
ENSDART00000132452 Essential Splice Site 751 1223 18 27
Genomic Location (Zv9):
Chromosome 5 (position 64939736)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61215226
GRCz11 5 61877963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATAATAGTGTNAAATGAACTAAATGAATGGTGAATCTGTGTCCTCCA[G/T]AGGTGGCAGCTCCCTGGACGGAGGAGACGGTGCGCCAGTGTCTTTACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link