zgc:162600

Ensembl ID:
ENSDARG00000059510
ZFIN ID:
ZDB-GENE-070410-84
Description:
para-hydroxybenzoate--polyprenyltransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_001082955]
Human Orthologue:
COQ2
Human Description:
coenzyme Q2 homolog, prenyltransferase (yeast) [Source:HGNC Symbol;Acc:25223]
Mouse Orthologues:
AC124779.2, Coq2
Mouse Description:
coenzyme Q2 homolog, prenyltransferase (yeast) Gene [Source:MGI Symbol;Acc:MGI:1919133]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12199 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082797 Nonsense 212 378 5 8
Genomic Location (Zv9):
Chromosome 5 (position 69194579)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65527844
GRCz11 5 66206949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTGTCRCTGGTGGTCACGTATCCTCTGATGAAGAGAATCACATACTG[G/A]CCTCAGTTTATTTTAGGTGCGCTACCATTAGTGTGCTAAATATTTCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link