zgc:158784

Ensembl ID:
ENSDARG00000059484
ZFIN ID:
ZDB-GENE-070209-59
Description:
huntingtin-interacting protein 1-related protein [Source:RefSeq peptide;Acc:NP_001077034]
Human Orthologue:
HIP1R
Human Description:
huntingtin interacting protein 1 related [Source:HGNC Symbol;Acc:18415]
Mouse Orthologue:
Hip1r
Mouse Description:
huntingtin interacting protein 1 related Gene [Source:MGI Symbol;Acc:MGI:1352504]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25320 Nonsense Mutation detected in F1 DNA During 2018
sa12666 Nonsense Available for shipment Available now
sa33759 Nonsense Mutation detected in F1 DNA During 2018
sa20580 Nonsense Available for shipment Available now
sa38525 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082726 Nonsense 365 1037 14 32
ENSDART00000127041 Nonsense 393 1065 14 32
ENSDART00000133846 Nonsense 220 916 8 25

The following transcripts of ENSDARG00000059484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69375220)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65708155
GRCz11 5 66387260
KASP Assay ID:
554-7704.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTCTGGTGTAATTTCAGGCTCAGCGCTATATCACGCAGCTGAAGGCA[C/T]AAATCAATAGCCTTGAGGGGGAACTGGAGGAACAGCGTATGCAGAAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082726 Nonsense 425 1037 15 32
ENSDART00000127041 Nonsense 453 1065 15 32
ENSDART00000133846 Nonsense 280 916 9 25

The following transcripts of ENSDARG00000059484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69374957)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65707892
GRCz11 5 66386997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTAATGRCTTTCTCATTTAGAAAGAGCCCAAGCAACAGAATTGCGTTA[T/G]AATAAACTGAMAGAAAAACATGCCGAACTGGTTGCCAACCACGCCGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082726 Nonsense 513 1037 17 32
ENSDART00000127041 Nonsense 541 1065 17 32
ENSDART00000133846 Nonsense 368 916 11 25

The following transcripts of ENSDARG00000059484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69372288)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65705223
GRCz11 5 66384328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGAGCTTGAAGCCAAAGCTGCAGAGATCCAAAAAGTCAGGAGTTCAT[T/A]GCAGACCTCTGAGATGGTATAGTATTTCTTCCATGTTAACAAACTTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082726 Nonsense 840 1037 27 32
ENSDART00000127041 Nonsense 868 1065 27 32
ENSDART00000133846 Nonsense 695 916 21 25

The following transcripts of ENSDARG00000059484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69359863)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65692798
GRCz11 5 66371903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTGTTGTTTTTTGTTTGTAGGGTGCAGCTTCAGTCAGAGAGTTTTA[T/A]GCGCGCAATTCTCGCTGGACAGAGGGTCTTATTTCTGCCTCCAAAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082726 Essential Splice Site 962 1037 None 32
ENSDART00000127041 Essential Splice Site 990 1065 None 32
ENSDART00000133846 Essential Splice Site 817 916 None 25

The following transcripts of ENSDARG00000059484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69357392)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65690327
GRCz11 5 66369432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGACTGTCTCTAATTAAGCTTAAAAAAGAAGAAATGGAATCACAGG[T/A]ATGTTTTGACGGAGCATTATGAAGTTTTATTACAATTAAAAGGCACAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link