LOC100334982

Ensembl ID:
ENSDARG00000059473
Human Orthologue:
KANK4
Human Description:
KN motif and ankyrin repeat domains 4 [Source:HGNC Symbol;Acc:27263]
Mouse Orthologue:
Kank4
Mouse Description:
KN motif and ankyrin repeat domains 4 Gene [Source:MGI Symbol;Acc:MGI:3043381]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45256 Nonsense Mutation detected in F1 DNA During 2018
sa20728 Essential Splice Site Available for shipment Available now
sa26766 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082698 Nonsense 408 1179 2 9
Genomic Location (Zv9):
Chromosome 6 (position 32174930)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32495846
GRCz11 6 32482760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACACTTCAAGAAGAAGCATCAAAGAGTCCCTCAGAGCAAGTAAAGGAG[C/T]AGGAGAGATCAGAGATTTTGCTTGAAGATAAACAGCCAACACTGTTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082698 Essential Splice Site 847 1179 3 9
Genomic Location (Zv9):
Chromosome 6 (position 32179400)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32500316
GRCz11 6 32487230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATGGGGGAGCGAAGAAGAACTTGAAGTTTGTTGGCGTAAATGGAGGG[T/C]ATGTGGATTTTATACATTTTTGGCATATTTTTCTGCATTTGAAACCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082698 Nonsense 1029 1179 7 9
Genomic Location (Zv9):
Chromosome 6 (position 32194561)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32515477
GRCz11 6 32502391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCCTTGAATTTATTAATGTTCTGTTCAATGGTGTGTTCAACAGGCT[T/A]GTGTGAGGTGGATCACCAGAATAAGGCAGGTTACACTGCTATAATGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link