si:dkey-70b23.1

Ensembl ID:
ENSDARG00000059472
ZFIN ID:
ZDB-GENE-100922-256
Human Orthologue:
ARHGAP31
Human Description:
Rho GTPase activating protein 31 [Source:HGNC Symbol;Acc:29216]
Mouse Orthologue:
Arhgap31
Mouse Description:
Rho GTPase activating protein 31 Gene [Source:MGI Symbol;Acc:MGI:1333857]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7014 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20586 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082696 Essential Splice Site 626 1304 16 21
ENSDART00000134386   None 554 None 10
Genomic Location (Zv9):
Chromosome 5 (position 70672938)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66998082
GRCz11 5 67676451
KASP Assay ID:
554-4903.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTAAGTAAGTCATTTATGGATGAACCATCTCTTTAAGCYACGTTCTTC[C/A]CTCAAAACATWATTTTTCCTGATTGTTCAAACAACTTATTTAAAATTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082696 Nonsense 1118 1304 21 21
ENSDART00000134386   None 554 None 10
Genomic Location (Zv9):
Chromosome 5 (position 70668459)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66993603
GRCz11 5 67671972
KASP Assay ID:
2259-6855.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACGCTGAGAAGAGCACTGATCAGGTCAACAAAAGCACACCTGAGAAG[A/T]AACCCACCAAAAGCAAGTTGGGAAAAGCAAGTTCTTTATTTCCCCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link