Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mepce
- Ensembl ID:
- ENSDARG00000059461
- ZFIN ID:
- ZDB-GENE-030131-3936
- Description:
- 7SK snRNA methylphosphate capping enzyme [Source:RefSeq peptide;Acc:NP_001122001]
- Human Orthologue:
- MEPCE
- Human Description:
- methylphosphate capping enzyme [Source:HGNC Symbol;Acc:20247]
- Mouse Orthologue:
- Mepce
- Mouse Description:
- methylphosphate capping enzyme Gene [Source:MGI Symbol;Acc:MGI:106477]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa31491 | Nonsense | Available for shipment | Available now |
| sa33774 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31491
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000082674 | Nonsense | 280 | 528 | 2 | 6 |
| ENSDART00000141699 | Nonsense | 405 | 701 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 5 (position 71683213)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 68007831 GRCz11 5 68778498 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTCGCATTCGTGTTATGAATCCGGATTGGTTCAGAGGGAAGGATGTGT[T/A]GGATCTGGGATGCAACACTGGCCACCTGACTCTGTTTATCGCAAAAAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33774
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000082674 | Essential Splice Site | 470 | 528 | 4 | 6 |
| ENSDART00000141699 | Essential Splice Site | 643 | 701 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 5 (position 71677832)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 68002450 GRCz11 5 68773117 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGGAGCCCCAGCCCTGGAGCTCCTACAACAAGAGGAAGAAGCTCACCG[T/C]AAGGCCACAACATTTTCATCACATCACTGATCATTTAAGATGCACAACAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
