si:dkey-267i17.5

Ensembl ID:
ENSDARG00000059423
ZFIN ID:
ZDB-GENE-050309-222
Description:
hypothetical protein LOC556822 [Source:RefSeq peptide;Acc:NP_001104624]
Human Orthologue:
PRUNE2
Human Description:
prune homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:25209]
Mouse Orthologue:
Prune2
Mouse Description:
prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38508 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082577 Nonsense 167 321 6 12
ENSDART00000145791 Nonsense 167 298 5 9
ENSDART00000147298 Nonsense 167 298 6 10
Genomic Location (Zv9):
Chromosome 5 (position 55977817)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54762487
GRCz11 5 55385323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAAATGCCATCATTGTGTTTGCTGCGTGCTTCCTTCCTGACAGTGAT[A/T]GAGAGGACTATCACGAGATCATGGAAAACCTCTTTCTGTGAGTTCATTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hippocampal atrophy: Hippocampal atrophy as a quantitative trait in a genome-wide association study identifying novel susceptibility genes for Alzheimer's disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link