zgc:110201

Ensembl ID:
ENSDARG00000059411
ZFIN ID:
ZDB-GENE-050522-349
Description:
inositol monophosphatase 2 [Source:RefSeq peptide;Acc:NP_001018408]
Human Orthologue:
IMPA2
Human Description:
inositol(myo)-1(or 4)-monophosphatase 2 [Source:HGNC Symbol;Acc:6051]
Mouse Orthologue:
Impa2
Mouse Description:
inositol (myo)-1(or 4)-monophosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:2149728]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25202 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24420 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082523 Essential Splice Site 65 275 2 8
Genomic Location (Zv9):
Chromosome 24 (position 277827)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 241710
GRCz11 24 793484
KASP Assay ID:
554-7674.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGCTGATCATCTCCACACTCAGAGAGAAATACCCTACACACAGG[T/C]ACACACACTCACACACACACTCATTTTAAAAGAAATACCCTGTGCGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082523 Essential Splice Site 100 275 3 8
Genomic Location (Zv9):
Chromosome 24 (position 278122)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 242005
GRCz11 24 793779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACCTGGATCATCGACCCCATCGACGGCACCTGTAACTTTGTGCACAG[G/C]TATGATATTGTGATATTATATATATTTGTTTATTATATTCATTATATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stroke: A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link