zgc:113390

Ensembl ID:
ENSDARG00000059394
ZFIN ID:
ZDB-GENE-050913-18
Description:
dermal papilla derived protein 13 [Source:RefSeq peptide;Acc:NP_001028898]
Human Orthologue:
C7orf10
Human Description:
chromosome 7 open reading frame 10 [Source:HGNC Symbol;Acc:16001]
Mouse Orthologue:
5033411D12Rik
Mouse Description:
RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25204 Essential Splice Site Mutation detected in F1 DNA During 2018
sa5985 Nonsense Mutation detected in F1 DNA During 2018
sa19338 Nonsense Mutation detected in F1 DNA During 2018
sa32472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082503 Essential Splice Site 46 231 5 10
ENSDART00000089409 Essential Splice Site 46 231 5 10
Genomic Location (Zv9):
Chromosome 24 (position 3380128)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3270621
GRCz11 24 3302408
KASP Assay ID:
554-7699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTGGGTTCCCCTTCCTGTTCATGATGTTTTTTTTTATATAATTGC[A/T]GAGCATTGCTGTTAACCTTAAATATCCAAAGGGGATCAAAGTTGTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082503 Nonsense 86 231 6 10
ENSDART00000089409 Nonsense 86 231 6 10
Genomic Location (Zv9):
Chromosome 24 (position 3379693)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3270186
GRCz11 24 3301973
KASP Assay ID:
554-3650.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTKCTGGAGAATTATTTGCCCGGGAAGCTGGGTGAGATGGGACTTGGGTA[C/A]GAGGAGTTGAGGAAAGTGGCGCCGCGGCTCATCTATTGYTCTATAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082503 Nonsense 89 231 6 10
ENSDART00000089409 Nonsense 89 231 6 10
Genomic Location (Zv9):
Chromosome 24 (position 3379685)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3270178
GRCz11 24 3301965
KASP Assay ID:
554-6205.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTATTTGCCCGGGAAGCTGGGTGAGATGGGACTTGGGTACGAGGAGT[T/A]GAGGAAAGTGGCGCCGCGGCTCATCTATTGCTCTATAACAGGTGCGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082503 Nonsense 169 231 8 10
ENSDART00000089409 Nonsense 169 231 8 10
Genomic Location (Zv9):
Chromosome 24 (position 3363210)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 3253703
GRCz11 24 3285490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCACGGAGCCATAATGGCCGCTTTGCTTCAGAGGCAGAAAACCGGA[C/T]GAGGCCTTCATATAGACTGCAATCTTCTGTCTTCACAGGTAATACTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link