
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113390
- Ensembl ID:
- ENSDARG00000059394
- ZFIN ID:
- ZDB-GENE-050913-18
- Description:
- dermal papilla derived protein 13 [Source:RefSeq peptide;Acc:NP_001028898]
- Human Orthologue:
- C7orf10
- Human Description:
- chromosome 7 open reading frame 10 [Source:HGNC Symbol;Acc:16001]
- Mouse Orthologue:
- 5033411D12Rik
- Mouse Description:
- RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25204 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa5985 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa19338 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32472 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa25204
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082503 | Essential Splice Site | 46 | 231 | 5 | 10 |
ENSDART00000089409 | Essential Splice Site | 46 | 231 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 24 (position 3380128)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 3270621 GRCz11 24 3302408 - KASP Assay ID:
- 554-7699.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAGTTGGGTTCCCCTTCCTGTTCATGATGTTTTTTTTTATATAATTGC[A/T]GAGCATTGCTGTTAACCTTAAATATCCAAAGGGGATCAAAGTTGTAACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5985
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082503 | Nonsense | 86 | 231 | 6 | 10 |
ENSDART00000089409 | Nonsense | 86 | 231 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 24 (position 3379693)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 3270186 GRCz11 24 3301973 - KASP Assay ID:
- 554-3650.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTKCTGGAGAATTATTTGCCCGGGAAGCTGGGTGAGATGGGACTTGGGTA[C/A]GAGGAGTTGAGGAAAGTGGCGCCGCGGCTCATCTATTGYTCTATAACAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19338
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082503 | Nonsense | 89 | 231 | 6 | 10 |
ENSDART00000089409 | Nonsense | 89 | 231 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 24 (position 3379685)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 3270178 GRCz11 24 3301965 - KASP Assay ID:
- 554-6205.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAATTATTTGCCCGGGAAGCTGGGTGAGATGGGACTTGGGTACGAGGAGT[T/A]GAGGAAAGTGGCGCCGCGGCTCATCTATTGCTCTATAACAGGTGCGCACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32472
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082503 | Nonsense | 169 | 231 | 8 | 10 |
ENSDART00000089409 | Nonsense | 169 | 231 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 24 (position 3363210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 3253703 GRCz11 24 3285490 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACTCACGGAGCCATAATGGCCGCTTTGCTTCAGAGGCAGAAAACCGGA[C/T]GAGGCCTTCATATAGACTGCAATCTTCTGTCTTCACAGGTAATACTACTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: