zgc:91960

Ensembl ID:
ENSDARG00000059365
ZFIN ID:
ZDB-GENE-040718-412
Description:
magnesium transporter NIPA4 [Source:RefSeq peptide;Acc:NP_001002664]
Human Orthologue:
NIPAL4
Human Description:
NIPA-like domain containing 4 [Source:HGNC Symbol;Acc:28018]
Mouse Orthologue:
Nipal4
Mouse Description:
NIPA-like domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2444671]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11592 Nonsense Available for shipment Available now
sa9713 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082469 Nonsense 115 407 3 6
ENSDART00000139320 Nonsense 119 411 3 6
Genomic Location (Zv9):
Chromosome 21 (position 25502237)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26072055
GRCz11 21 26108750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTTTAGCCGAGGGAGGTCATGGGTACCTGAAAGACTGGCTATGGT[G/A]GGGAGGCCTTTTGACAAGTAAGTGCAATGCAAAGCAATTGTAAATAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082469 Essential Splice Site 205 407 5 6
ENSDART00000139320 Essential Splice Site 209 411 5 6
Genomic Location (Zv9):
Chromosome 21 (position 25493410)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26063228
GRCz11 21 26099923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAGGTGACCACACTTAAAGAAATGGCCGAGAAACTCCTTGATCCTGG[T/C]TAGTGTTAAAATTCCTTTAAWTTTTGAACTCCAAAAGCAGTTGCTATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link