
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TGFBR2 (2 of 2)
- Ensembl ID:
- ENSDARG00000059363
- Description:
- transforming growth factor, beta receptor II (70/80kDa) [Source:HGNC Symbol;Acc:11773]
- Human Orthologue:
- TGFBR2
- Human Description:
- transforming growth factor, beta receptor II (70/80kDa) [Source:HGNC Symbol;Acc:11773]
- Mouse Orthologue:
- Tgfbr2
- Mouse Description:
- transforming growth factor, beta receptor II Gene [Source:MGI Symbol;Acc:MGI:98729]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23405 | Nonsense | Available for shipment | Available now |
sa43192 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43193 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12495 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23405
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082466 | Nonsense | 32 | 659 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 953757)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 1280309 GRCz11 19 917905 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCTGGTGTTTCTGCAGCTCTTCTCCGCACTGCTGATCTCCGCATCTG[C/A]AGCTCCTGTAAGCCTCATCCAGTCAACTGTGTGTCAAATCAGTGCTTCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43192
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082466 | Nonsense | 104 | 659 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 955717)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 1282269 GRCz11 19 919865 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGATGCTCGGTGTGATGGTGGAGGATATTCTCATCTCGGAGTGTGTGTTG[C/T]AGGAACAAAACATTCACGGAAGACACCTGCGTGTGTGTAGCTGCACAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43193
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082466 | Nonsense | 106 | 659 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 955723)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 1282275 GRCz11 19 919871 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGGTGTGATGGTGGAGGATATTCTCATCTCGGAGTGTGTGTTGCAGGAA[C/T]AAAACATTCACGGAAGACACCTGCGTGTGTGTAGCTGCACAGGAGACCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12495
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082466 | Nonsense | 352 | 659 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 961047)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 1287599 GRCz11 19 925253 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAACACTGAGCTGCTGCCCATCCAGCTGGACAGAGTTGTGGGAAAAGGA[C/T]GAWTCGCAGACGTTTATAAAGCCAAGCTGAAGCAGAGCGCAGACTCCTTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)
- Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: