slc39a4

Ensembl ID:
ENSDARG00000059361
ZFIN ID:
ZDB-GENE-060315-8
Description:
solute carrier family 39 (zinc transporter), member 4 [Source:RefSeq peptide;Acc:NP_001124249]
Human Orthologue:
SLC39A4
Human Description:
solute carrier family 39 (zinc transporter), member 4 [Source:HGNC Symbol;Acc:17129]
Mouse Orthologue:
Slc39a4
Mouse Description:
solute carrier family 39 (zinc transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:1919277]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10372 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082465 Essential Splice Site 44 149 1 3
Genomic Location (Zv9):
Chromosome 19 (position 1119243)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1411868
GRCz11 19 1127390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTGGCCACATCACTGGCGGTTCTCTGTCATGAGCTACCACACGAGTTAG[G/C]TGAGACTNTCACACACACAAACACACACAYAAATACACACAAACACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link