srsf3b

Ensembl ID:
ENSDARG00000059360
ZFIN ID:
ZDB-GENE-071005-2
Description:
splicing factor, arginine/serine-rich 3b [Source:RefSeq peptide;Acc:NP_958480]
Human Orthologue:
SRSF3
Human Description:
serine/arginine-rich splicing factor 3 [Source:HGNC Symbol;Acc:10785]
Mouse Orthologues:
Gm12355, Srsf3
Mouse Descriptions:
predicted gene 12355 Gene [Source:MGI Symbol;Acc:MGI:3649769]
serine/arginine-rich splicing factor 3 Gene [Source:MGI Symbol;Acc:MGI:98285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24045 Essential Splice Site Available for shipment Available now
sa13439 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106636 Essential Splice Site None 164 None 6
ENSDART00000135829 Essential Splice Site None 164 None 7
ENSDART00000137264 Essential Splice Site None 124 None 4
ENSDART00000144309   None 164 None 6
ENSDART00000145685 Essential Splice Site None 164 None 7

The following transcripts of ENSDARG00000059360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 596703)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 583811
GRCz11 22 621534
KASP Assay ID:
2261-6178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGAATCAAACACACACACACGGCCAGAAATACGCGATAATTACGG[T/A]GAGTTGTGTTTTTTCTCTTCCATTACGAAATAATGTTTCCAAACGAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106636 Essential Splice Site 114 164 None 6
ENSDART00000135829 Essential Splice Site 114 164 None 7
ENSDART00000137264 Essential Splice Site 114 124 None 4
ENSDART00000144309 Essential Splice Site 114 164 None 6
ENSDART00000145685 Essential Splice Site 114 164 None 7

The following transcripts of ENSDARG00000059360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 593221)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 580329
GRCz11 22 618052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KCCCACGGGATGACTACCGCCGCCGCAGCNNNCCGCCCCAGAGGCGCAGG[T/C]AAACCTGTCCTCCGCTCACCTGTCTCTCTGTAGCTTGTGTTTCAGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link