zgc:109957

Ensembl ID:
ENSDARG00000059357
ZFIN ID:
ZDB-GENE-050522-161
Description:
SAP domain-containing ribonucleoprotein [Source:RefSeq peptide;Acc:NP_001019578]
Human Orthologue:
SARNP
Human Description:
SAP domain containing ribonucleoprotein [Source:HGNC Symbol;Acc:24432]
Mouse Orthologue:
Sarnp
Mouse Description:
SAP domain containing ribonucleoprotein Gene [Source:MGI Symbol;Acc:MGI:1913368]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2598 Essential Splice Site F2 line generated During 2018
sa13759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2598
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082458 Essential Splice Site 192 204 11 11
Genomic Location (Zv9):
Chromosome 11 (position 3299155)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3250544
GRCz11 11 3318704
KASP Assay ID:
554-2841.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAATGTAGTATTACTGTCTCTCACAATGTATCCCTCTCTTTCTTTTCC[A/T]GGCAAAGAAGCGGAAACGTGCCGAGCGGTTTGGAAATGTATAAATAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082458 Nonsense 202 204 11 11
Genomic Location (Zv9):
Chromosome 11 (position 3299187)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3250576
GRCz11 11 3318736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTCTCTTTCTTTTCCWGGCAAAGAAGCGGAAACGTGCCGAGCGGTTT[G/T]GAAATGTATAAATAAACGGATCAATTTTTATACCTTTTTCATTTTTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link