zgc:92308

Ensembl ID:
ENSDARG00000059354
ZFIN ID:
ZDB-GENE-040912-142
Description:
Lysosomal protein NCU-G1 [Source:UniProtKB/Swiss-Prot;Acc:Q66HW4]
Human Orthologue:
C1orf85
Human Description:
chromosome 1 open reading frame 85 [Source:HGNC Symbol;Acc:29436]
Mouse Orthologue:
0610031J06Rik
Mouse Description:
RIKEN cDNA 0610031J06 gene Gene [Source:MGI Symbol;Acc:MGI:1913318]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44901 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082454 Nonsense 295 407 5 6

The following transcripts of ENSDARG00000059354 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 779991)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 801478
GRCz11 19 801287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCAGTCAGTGGAAGCCGGTGGCGTACCGTAAAGCTCGTCCCGTGTTC[G/T]AGGACGCCACCGCCTGCAGACACTCAGAGCTGGTGTTTGTGAACGGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link