
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
calml4
- Ensembl ID:
- ENSDARG00000059347
- ZFIN ID:
- ZDB-GENE-071009-6
- Human Orthologue:
- CALML4
- Human Description:
- calmodulin-like 4 [Source:HGNC Symbol;Acc:18445]
- Mouse Orthologue:
- Calml4
- Mouse Description:
- calmodulin-like 4 Gene [Source:MGI Symbol;Acc:MGI:1922850]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37975 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa30175 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37975
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082447 | Essential Splice Site | 11 | 155 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 25 (position 1389363)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 1242943 GRCz11 25 1323588 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTCTTATGTTCTTACAGGCGAAATTCCTCAGTCAAGATCAAATCAACG[G/A]TAAGCAGGTCTCTGCATTATAACGTCTCTTATAGATATTGTGTAAATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30175
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082447 | Essential Splice Site | 12 | 155 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 25 (position 1389364)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 1242942 GRCz11 25 1323587 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTCTTATGTTCTTACAGGCGAAATTCCTCAGTCAAGATCAAATCAACGG[T/G]AAGCAGGTCTCTGCATTATAACGTCTCTTATAGATATTGTGTAAATATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: