zgc:136857

Ensembl ID:
ENSDARG00000059342
ZFIN ID:
ZDB-GENE-060421-6683
Description:
advillin [Source:RefSeq peptide;Acc:NP_001035455]
Human Orthologue:
AVIL
Human Description:
advillin [Source:HGNC Symbol;Acc:14188]
Mouse Orthologue:
Avil
Mouse Description:
advillin Gene [Source:MGI Symbol;Acc:MGI:1333798]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1324 Essential Splice Site Available for shipment Available now
sa41745 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104546 Essential Splice Site 46 811 4 20
Genomic Location (Zv9):
Chromosome 11 (position 228904)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 217445
GRCz11 11 179880
KASP Assay ID:
554-1238.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACAACATCATAAATGCATGTGTTCTTCCTCTCCTGCCTTCCGCTTGC[A/T]GACATGCAAATCTGGCAAAACGAYATCTTATGACATCCATTACTGGATCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104546 Nonsense 457 811 13 20
Genomic Location (Zv9):
Chromosome 11 (position 223893)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 212434
GRCz11 11 174869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCCTCAGGGCCGGCATGCGTCTCAGGATGAAGTGACGGCGTGTGCGTA[T/G]CATGCGGTGACGGTGGATCAGCAGTACGGAGGTCAGCCGGTGCAGGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link