si:zfos-2326c3.2

Ensembl ID:
ENSDARG00000059317
ZFIN ID:
ZDB-GENE-091113-25
Human Orthologue:
NRK
Human Description:
Nik related kinase [Source:HGNC Symbol;Acc:25391]
Mouse Orthologue:
Nrk
Mouse Description:
Nik related kinase Gene [Source:MGI Symbol;Acc:MGI:1351326]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16332 Nonsense Available for shipment Available now
sa38982 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13811 Nonsense Available for shipment Available now
sa13810 Essential Splice Site Available for shipment Available now
sa42350 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044203 Nonsense 296 1165 10 32
ENSDART00000138586 Nonsense 292 1063 10 29
Genomic Location (Zv9):
Chromosome 14 (position 9866284)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9361641
GRCz11 14 9667655
KASP Assay ID:
2260-7300.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGAGACGCTYTTACGSCATTCCTTTATTAAAGRCCTTCCCAATGAA[C/T]GACAAGTACGAATCACACTTAAAGATCAWCTGGACAGAACCAGGAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044203 Essential Splice Site 661 1165 20 32
ENSDART00000138586 Essential Splice Site 559 1063 17 29
Genomic Location (Zv9):
Chromosome 14 (position 9844591)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9339948
GRCz11 14 9645962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCCAAACAGAAACTCTCAAAGTCCAGGAGCATCACCACACAACCAG[G/A]TGTGAATCTGCATCACATGTATATCAGATGATTTTGCAGTTAGTTTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044203 Nonsense 718 1165 22 32
ENSDART00000138586 Nonsense 616 1063 19 29
Genomic Location (Zv9):
Chromosome 14 (position 9839024)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9334381
GRCz11 14 9640395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGGGCAGACTAATGAAATCATTCTTCAGCCTCATCTCAATGTAAAA[C/T]AGCRGCAGGTAAARTCACCTTCACTATGTTGTTTTAGGGACMGTACGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044203 Essential Splice Site 809 1165 24 32
ENSDART00000138586 Essential Splice Site 707 1063 21 29
Genomic Location (Zv9):
Chromosome 14 (position 9835216)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9330573
GRCz11 14 9636587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTTTGCTTCAGATTTCTCCACCTCTGAGTCCGCAGGGACACKGCCAGC[G/T]TGAGTCCACATGACTGACAGCCACTGACATACATGCATGTCACATTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044203 Nonsense 952 1165 27 32
ENSDART00000138586 Nonsense 850 1063 24 29
Genomic Location (Zv9):
Chromosome 14 (position 9822422)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9317779
GRCz11 14 9623793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAACAGGGCTGGACCTCTGTGGGGGACCTGGAGGGATGTGTCAGCTA[C/A]AAAGTAGGTGAGTCTAGAACTGATCTCTATACTCGTTACATTTCTGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link