dpysl5b

Ensembl ID:
ENSDARG00000059311
ZFIN ID:
ZDB-GENE-050720-4
Description:
dihydropyrimidinase-related protein 5 [Source:RefSeq peptide;Acc:NP_001018351]
Human Orthologue:
DPYSL5
Human Description:
dihydropyrimidinase-like 5 [Source:HGNC Symbol;Acc:20637]
Mouse Orthologue:
Dpysl5
Mouse Description:
dihydropyrimidinase-like 5 Gene [Source:MGI Symbol;Acc:MGI:1929772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20168 Nonsense Available for shipment Available now
sa45162 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067455 Nonsense 334 568 9 13
ENSDART00000134323 Nonsense 334 568 8 12
Genomic Location (Zv9):
Chromosome 4 (position 575017)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 792933
GRCz11 4 806381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGACATCATTAACGTGGTGGCGTCAGATCATCGCGCATTCAGCACCAAG[C/T]AGAAGGCCATGGGCAAAGAAGACTTCACGAAGATCCCTCACGGGGCGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067455 Essential Splice Site 412 568 10 13
ENSDART00000134323 Essential Splice Site 412 568 9 12
Genomic Location (Zv9):
Chromosome 4 (position 572774)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 790690
GRCz11 4 804138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGAGCCGATGCGGATGTGGTTGTGTGGGATCCAGACGCCACACGG[T/C]ACAAGATGATAATAACCGTATTTGGAAAAGCACAGTTTAATGTAGTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link