
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-241b2.5
- Ensembl ID:
- ENSDARG00000059310
- ZFIN ID:
- ZDB-GENE-081104-192
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A5Z7]
- Human Orthologues:
- CD274, PDCD1LG2
- Human Descriptions:
- CD274 molecule [Source:HGNC Symbol;Acc:17635]
- programmed cell death 1 ligand 2 [Source:HGNC Symbol;Acc:18731]
- Mouse Orthologues:
- Cd274, Pdcd1lg2
- Mouse Descriptions:
- CD274 antigen Gene [Source:MGI Symbol;Acc:MGI:1926446]
- programmed cell death 1 ligand 2 Gene [Source:MGI Symbol;Acc:MGI:1930125]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43560 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa37203 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32323 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43560
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082395 | Essential Splice Site | 274 | 502 | 6 | 9 |
ENSDART00000139098 | Essential Splice Site | 268 | 465 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 21 (position 2498349)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 2374386 GRCz11 21 2400210 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATAATCTATCATATAAACGTGTGTGTGACCTCTGCTTTATCTGTTGAC[A/G]GGTCAGAAAAACAGAAGAAACGAAGCCTCTAAATGTGCTTACCTCTTCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37203
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082395 | Nonsense | 452 | 502 | 9 | 9 |
ENSDART00000139098 | Nonsense | 446 | 465 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 21 (position 2503277)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 2369458 GRCz11 21 2395282 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCAGTCTCTTAAAGGGCCGGAGGACTGTTTGCTGATCCTCGATGATTA[T/A]CAAGAGGGAAATAAAGACTTGGAGGAGTTTTTAAAGGACCATCAGACGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32323
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082395 | Nonsense | 454 | 502 | 9 | 9 |
ENSDART00000139098 | Nonsense | 448 | 465 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 21 (position 2503281)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 2369454 GRCz11 21 2395278 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCTCTTAAAGGGCCGGAGGACTGTTTGCTGATCCTCGATGATTATCAA[G/T]AGGGAAATAAAGACTTGGAGGAGTTTTTAAAGGACCATCAGACGTGTCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: