tmem37

Ensembl ID:
ENSDARG00000059305
ZFIN ID:
ZDB-GENE-040426-2208
Description:
voltage-dependent calcium channel gamma-like subunit [Source:RefSeq peptide;Acc:NP_998339]
Human Orthologue:
TMEM37
Human Description:
transmembrane protein 37 [Source:HGNC Symbol;Acc:18216]
Mouse Orthologue:
Tmem37
Mouse Description:
transmembrane protein 37 Gene [Source:MGI Symbol;Acc:MGI:2157899]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31694 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082390 Nonsense 60 211 2 2
Genomic Location (Zv9):
Chromosome 9 (position 906532)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 920684
GRCz11 9 920193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGACGGTCACTGGCTGCTCTCCGGCCAACACATGTTCGGCCTGTG[G/A]TATTTCTGCTCTGTGGAGGTGCCTCAGGGCTCGGTGTTGGGCCCCCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link