
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mak
- Ensembl ID:
- ENSDARG00000059287
- ZFIN ID:
- ZDB-GENE-030131-7279
- Description:
- serine/threonine-protein kinase MAK [Source:RefSeq peptide;Acc:NP_956240]
- Human Orthologue:
- MAK
- Human Description:
- male germ cell-associated kinase [Source:HGNC Symbol;Acc:6816]
- Mouse Orthologue:
- Mak
- Mouse Description:
- male germ cell-associated kinase Gene [Source:MGI Symbol;Acc:MGI:96913]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13538 | Nonsense | Available for shipment | Available now |
sa37825 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13538
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082362 | Nonsense | 164 | 633 | 6 | 15 |
- Genomic Location (Zv9):
- Chromosome 24 (position 8563484)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 8623286 GRCz11 24 8763672 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGCACGTGAGATCCGCTCTCGGCCACCTTACACAGACTACGTCTCAACR[C/T]GATGGTAAGAGTGYAAAAACACTGTATTGGGACATCACAYTAGCACCCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37825
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082362 | Nonsense | 580 | 633 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 24 (position 8542243)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 8602263 GRCz11 24 8742645 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCTTCAAAGTCCAAACCTTCCTCTACAGTTTCAGTCAATGATAACTCT[G/T]AAGGTAAAAGCTTAGATCAATAGCAGTCTATTAAAATAATAATCACGAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: