
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tfap2a
- Ensembl ID:
- ENSDARG00000059279
- ZFIN IDs:
- ZDB-GENE-011212-6, ZDB-GENE-011212-6, ZDB-GENE-011212-6
- Description:
- transcription factor AP-2-alpha [Source:RefSeq peptide;Acc:NP_789829]
- Human Orthologue:
- TFAP2A
- Human Description:
- transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) [Source:HGNC Symbol;Ac
- Mouse Orthologue:
- Tcfap2a
- Mouse Description:
- transcription factor AP-2, alpha Gene [Source:MGI Symbol;Acc:MGI:104671]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24445 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24445
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082346 | Nonsense | 224 | 425 | 4 | 7 |
ENSDART00000082349 | Nonsense | 230 | 431 | 4 | 7 |
ENSDART00000082351 | Nonsense | 236 | 437 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 8525292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 8585317 GRCz11 24 8725695 - KASP Assay ID:
- 2261-8431.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTTCTCAGCTCAACGTCAAAGTACAAAGTCACAGTAGCGGAGGTGCAG[A/T]GACGTCTTTCTCCGCCTGAGTGCCTGAACGCTTCCTTGCTCGGCGGCGTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: