zpcx

Ensembl ID:
ENSDARG00000059252
ZFIN ID:
ZDB-GENE-040824-1
Description:
zona pellucida protein C [Source:RefSeq peptide;Acc:NP_001012244]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17888 Essential Splice Site Available for shipment Available now
sa11981 Nonsense Available for shipment Available now
sa23086 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082324 Essential Splice Site 90 552 2 7
Genomic Location (Zv9):
Chromosome 17 (position 25120940)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25312631
GRCz11 17 25331022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTANNNATCCATTAGATATGGTRTTTTACAATCWGATGTWTGTTTTGYTCT[A/T]GCGTTTTGGACTGAACMAGCAGATACGAAAGTGTTCCAGAAAGGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082324 Nonsense 191 552 4 7
Genomic Location (Zv9):
Chromosome 17 (position 25120479)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25312170
GRCz11 17 25330561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTTTGCTTTTAGAGTTATATTCACTGCAAAGTGTATCTTACTGATT[T/A]GGGCCTGACCTCWGCCACTAAATTCTGCAACTACAACAAGCGCAAATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082324 Nonsense 368 552 6 7
Genomic Location (Zv9):
Chromosome 17 (position 25119000)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25310691
GRCz11 17 25329082
KASP Assay ID:
2261-1079.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACCTGCTGTTGACGTAACCGTTCAGCTTGAAAATTTGATTCCAGAT[C/T]AAAGTGCATTTAAGAAAAGTCAGGCTGTGAATGAAGCCAAGGTTGATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link