
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zpcx
- Ensembl ID:
- ENSDARG00000059252
- ZFIN ID:
- ZDB-GENE-040824-1
- Description:
- zona pellucida protein C [Source:RefSeq peptide;Acc:NP_001012244]
- Human Orthologues:
- POMZP3, ZP3
- Human Descriptions:
- POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
- zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
- Mouse Orthologue:
- Zp3
- Mouse Description:
- zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17888 | Essential Splice Site | Available for shipment | Available now |
sa11981 | Nonsense | Available for shipment | Available now |
sa23086 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17888
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082324 | Essential Splice Site | 90 | 552 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25120940)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25312631 GRCz11 17 25331022 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTANNNATCCATTAGATATGGTRTTTTACAATCWGATGTWTGTTTTGYTCT[A/T]GCGTTTTGGACTGAACMAGCAGATACGAAAGTGTTCCAGAAAGGAGAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11981
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082324 | Nonsense | 191 | 552 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25120479)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25312170 GRCz11 17 25330561 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTGTTTGCTTTTAGAGTTATATTCACTGCAAAGTGTATCTTACTGATT[T/A]GGGCCTGACCTCWGCCACTAAATTCTGCAACTACAACAAGCGCAAATCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23086
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082324 | Nonsense | 368 | 552 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 17 (position 25119000)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 25310691 GRCz11 17 25329082 - KASP Assay ID:
- 2261-1079.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAACCTGCTGTTGACGTAACCGTTCAGCTTGAAAATTTGATTCCAGAT[C/T]AAAGTGCATTTAAGAAAAGTCAGGCTGTGAATGAAGCCAAGGTTGATGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: