zgc:113274

Ensembl ID:
ENSDARG00000059235
ZFIN ID:
ZDB-GENE-050508-2
Description:
hypothetical protein LOC552925 [Source:RefSeq peptide;Acc:NP_001018331]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27545 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34822 Essential Splice Site Available for shipment Available now
sa1758 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa27545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082295 Essential Splice Site None 203 2 6
ENSDART00000132627 Essential Splice Site None 135 2 4
ENSDART00000082295 Essential Splice Site None 203 2 6
ENSDART00000132627 Essential Splice Site None 135 2 4
Genomic Location (Zv9):
Chromosome 10 (position 5143937)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5140231
GRCz11 10 5140535
KASP Assay ID:
2260-2806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTATCATATCCAGCTATCAGTAAATGAAAGAAACACAAAGGATAAGTGG[T/A]AAGTTGTTGTTTAAATGTATTGACTGCAATTTAGTCCTTGCTAAATAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082295 Essential Splice Site None 203 2 6
ENSDART00000132627 Essential Splice Site None 135 2 4
ENSDART00000082295 Essential Splice Site None 203 2 6
ENSDART00000132627 Essential Splice Site None 135 2 4
Genomic Location (Zv9):
Chromosome 10 (position 5143937)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5140231
GRCz11 10 5140535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTATCATATCCAGCTATCAGTAAATGAAAGAAACACAAAGGATAAGTGG[T/A]AAGTTGTTGTTTAAATGTATTGACTGCAATTTAGTCCTTGCTAAATAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082295 Essential Splice Site 154 203 4 6
ENSDART00000132627   None 135 None 4
Genomic Location (Zv9):
Chromosome 10 (position 5147748)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5144042
GRCz11 10 5144346
KASP Assay ID:
554-1751.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTACGGCCATCTTACTGAAGCAGCGTCTTTGGAAAGTCATGGACAGG[T/C]GACAGAGCCAACATTTTTCACTAAATGAAAGTTCCTGCAGTCATGGAAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link