zgc:100970

Ensembl ID:
ENSDARG00000059234
ZFIN ID:
ZDB-GENE-040808-39
Description:
28S ribosomal protein S27, mitochondrial [Source:RefSeq peptide;Acc:NP_001003778]
Human Orthologue:
MRPS27
Human Description:
mitochondrial ribosomal protein S27 [Source:HGNC Symbol;Acc:14512]
Mouse Orthologue:
Mrps27
Mouse Description:
mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12506 Splice Site, Nonsense Available for shipment Available now
sa535 Essential Splice Site Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa12506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092773 Splice Site, Nonsense 94 398 4 11
Genomic Location (Zv9):
Chromosome 8 (position 983013)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 871532
GRCz11 8 937275
KASP Assay ID:
2260-0004.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAAYATATCATCCAGAGATGAAGTGGATCAAGCAGAATATTACCTGTA[T/G]AAGTGAGTATCTTGGCTTTATTTTAATGTTTTGTTCAGGTGTTGGTKTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa535
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092773 Essential Splice Site 280 398 9 11
Genomic Location (Zv9):
Chromosome 8 (position 986437)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 868108
GRCz11 8 933851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCCGTGAGTTCAGACTTCACAGGCGTGCAGATCTCCGAGGACGCGG[T/C]GAGTGTGTGTTCATCACAAGAAGGATAGATGACCATAATGAGCCCTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link