abhd13

Ensembl ID:
ENSDARG00000059209
ZFIN ID:
ZDB-GENE-051120-54
Description:
Abhydrolase domain-containing protein 13 [Source:UniProtKB/Swiss-Prot;Acc:Q32LS6]
Human Orthologue:
ABHD13
Human Description:
abhydrolase domain containing 13 [Source:HGNC Symbol;Acc:20293]
Mouse Orthologue:
Abhd13
Mouse Description:
abhydrolase domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:1916154]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41347 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082260 Essential Splice Site None 337 1 2
Genomic Location (Zv9):
Chromosome 9 (position 5362403)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 5502443
GRCz11 9 5350869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTAAACCCAGCTCCCTGAAGATGTGCCGCTGAAGAATGCGCTAGATG[T/A]GAGTAGTTTCGTATCAGGCTGTCAGCAGATGTGTGCTAGACATTGCTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link