zgc:153639

Ensembl ID:
ENSDARG00000059166
ZFIN ID:
ZDB-GENE-061013-532
Description:
solute carrier family 22, member 13 [Source:RefSeq peptide;Acc:NP_001070840]
Human Orthologues:
SLC22A13, SLC22A14
Human Descriptions:
solute carrier family 22 (organic anion transporter), member 13 [Source:HGNC Symbol;Acc:8494]
solute carrier family 22, member 14 [Source:HGNC Symbol;Acc:8495]
Mouse Orthologues:
Slc22a13, Slc22a14
Mouse Descriptions:
solute carrier family 22 (organic cation transporter), member 13 Gene [Source:MGI Symbol;Acc:MGI:214
solute carrier family 22 (organic cation transporter), member 14 Gene [Source:MGI Symbol;Acc:MGI:268

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37868 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082201 Nonsense 227 508 4 9
ENSDART00000121740 Nonsense 227 415 4 7
ENSDART00000146340 Nonsense 227 542 4 10
Genomic Location (Zv9):
Chromosome 24 (position 20621214)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19868343
GRCz11 24 20012762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGGTACTGAGTGGTGTGGTTCAGCCAAGCGGGCCCTTTTCACCATAT[T/G]ATCGCACTGCTTTTTTGCCATTGGTCTGATGTTGCTGTCTGGTGTGGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link