
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
irbp
- Ensembl ID:
- ENSDARG00000059163
- ZFIN ID:
- ZDB-GENE-990415-132
- Description:
- Interphotoreceptor retinoid-binding protein [Source:UniProtKB/TrEMBL;Acc:O57689]
- Human Orthologue:
- RBP3
- Human Description:
- retinol binding protein 3, interstitial [Source:HGNC Symbol;Acc:9921]
- Mouse Orthologue:
- Rbp3
- Mouse Description:
- retinol binding protein 3, interstitial Gene [Source:MGI Symbol;Acc:MGI:97878]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41931 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa5849 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11103 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa41931
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082200 | Nonsense | 659 | 1202 | 1 | 5 |
ENSDART00000082203 | None | 627 | None | 5 | |
ENSDART00000147532 | None | 631 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 3240971)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 2627971 GRCz11 12 2662704 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAACCGAGGGACTGTACCGCTCTGTTGTCGACTATGAATCTCTTGCATCT[C/T]AGCTCACTTCAGATCTCCAAGAGACCTCGGGTGATCAGAGACTGCATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5849
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082200 | Nonsense | 884 | 1202 | 1 | 5 |
ENSDART00000082203 | None | 627 | None | 5 | |
ENSDART00000147532 | None | 631 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 3241646)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 2628646 GRCz11 12 2663379 - KASP Assay ID:
- 554-3801.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGCAGTTCTGAATGCAGTTACTGGAAAACCATGGAGCATTTCAGGAGTT[G/T]AACCACATATAGTAGCTCAAGCAAGTGATGCACTTATTGTTGCACAGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11103
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082200 | Nonsense | 1101 | 1202 | 5 | 5 |
ENSDART00000082203 | Nonsense | 514 | 627 | 4 | 5 |
ENSDART00000147532 | Nonsense | 530 | 631 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 3247655)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 2634655 GRCz11 12 2669388 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAACTGATGCATTAAATTCCACTTTTCYCTAGGCAGRAGATATGGMAGC[A/T]AGAAAAGTGTGGTAATCCTCACCAGTGGTGTGACCGCCGGTGCCGCTGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: