zgc:63514

Ensembl ID:
ENSDARG00000059158
ZFIN ID:
ZDB-GENE-030131-8356
Description:
four and a half LIM domains 3 [Source:RefSeq peptide;Acc:NP_001093448]
Human Orthologue:
FHL3
Human Description:
four and a half LIM domains 3 [Source:HGNC Symbol;Acc:3704]
Mouse Orthologue:
Fhl3
Mouse Description:
four and a half LIM domains 3 Gene [Source:MGI Symbol;Acc:MGI:1341092]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16053 Essential Splice Site Available for shipment Available now
sa13682 Nonsense Available for shipment Available now
sa29137 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Essential Splice Site 110 290 2 5
ENSDART00000132380 Essential Splice Site 110 290 4 7
ENSDART00000139225 Essential Splice Site 110 225 3 5
Genomic Location (Zv9):
Chromosome 19 (position 4891886)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4165447
GRCz11 19 4096273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGAGTTTTCTTCTAATTGTGTGGCCTGCGGGAAGACWGTGATGCCAG[G/A]TAACCTTMACACAMACACGYATATGCTAGWATTTTATTTWTATACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Nonsense 120 290 3 5
ENSDART00000132380 Nonsense 120 290 5 7
ENSDART00000139225 Nonsense 120 225 4 5
Genomic Location (Zv9):
Chromosome 19 (position 4890092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4163653
GRCz11 19 4094479
KASP Assay ID:
2261-2828.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTATATATTGTCCTCTCAGGCTCTAAGMGGCTGGAGTATGAAGACTG[T/A]GTGTGGCATGAGGAGTGTTTTGTTTGCTGTGGTTGTGAGCAGCCCATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082192 Nonsense 122 290 3 5
ENSDART00000132380 Nonsense 122 290 5 7
ENSDART00000139225 Nonsense 122 225 4 5
Genomic Location (Zv9):
Chromosome 19 (position 4890086)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4163647
GRCz11 19 4094473
KASP Assay ID:
2261-2827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTGTCCTCTCAGGCTCTAAGCGGCTGGAGTATGAAGACTGTGTGTG[G/A]CATGAGGAGTGTTTTGTTTGCTGTGGTTGTGAGCAGCCCATCGGCGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link