
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TMEM128
- Ensembl ID:
- ENSDARG00000059150
- Description:
- transmembrane protein 128 [Source:HGNC Symbol;Acc:28201]
- Human Orthologue:
- TMEM128
- Human Description:
- transmembrane protein 128 [Source:HGNC Symbol;Acc:28201]
- Mouse Orthologue:
- Tmem128
- Mouse Description:
- transmembrane protein 128 Gene [Source:MGI Symbol;Acc:MGI:1913559]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22395 | Nonsense | Available for shipment | Available now |
sa28220 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22395
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082184 | Nonsense | 6 | 152 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 14 (position 146849)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 215195 GRCz11 14 39171 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAGCCGAGCGCCATGGCGGACTTCAGTGAGGTGATGAACCTGCGGCGG[C/T]GATTCAAAACAAACGAACAAGAAGAGGAGAGAGAGCAGAGTGAGACACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28220
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082184 | Nonsense | 12 | 152 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 14 (position 146831)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 215177 GRCz11 14 39189 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGACTTCAGTGAGGTGATGAACCTGCGGCGGCGATTCAAAACAAACGAA[C/T]AAGAAGAGGAGAGAGAGCAGAGTGAGACACACACACACACACACACACAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: