spdya

Ensembl ID:
ENSDARG00000059131
ZFIN ID:
ZDB-GENE-041010-194
Description:
speedy protein A [Source:RefSeq peptide;Acc:NP_001006091]
Human Orthologue:
SPDYA
Human Description:
speedy homolog A (Xenopus laevis) [Source:HGNC Symbol;Acc:30613]
Mouse Orthologue:
Spdya
Mouse Description:
speedy homolog A (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1918141]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36413 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23081 Essential Splice Site Available for shipment Available now
sa42937 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082251   None 289 None 7
ENSDART00000130871 Essential Splice Site None 289 None 7
ENSDART00000135986   None 271 None 5
ENSDART00000147871 Essential Splice Site None 228 None 6

The following transcripts of ENSDARG00000059131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 24637626)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24791068
GRCz11 17 24809469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCGCGTCGCACCATGTCATTCCTGAGCGGCGGGTTTTTAAACTGAGG[T/C]AAATGGGTTTACCGGTAAAAAAAACTCGATTAAATGGGCATATAAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082251 Essential Splice Site 69 289 None 7
ENSDART00000130871 Essential Splice Site 69 289 None 7
ENSDART00000135986 Essential Splice Site 69 271 None 5
ENSDART00000147871 Essential Splice Site 69 228 None 6

The following transcripts of ENSDARG00000059131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 24638123)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24791565
GRCz11 17 24809966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGCTAATCCAGAGACAAGAGATGGCCGCCTTCTTCAGACTGTTCGG[T/C]GGGTTCAGCAAAGCAGCTGCCAGTGATACTCATTAAACTAAATGTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082251 Essential Splice Site 270 289 None 7
ENSDART00000130871 Essential Splice Site 270 289 None 7
ENSDART00000135986   270 271 5 5
ENSDART00000147871   None 228 None 6

The following transcripts of ENSDARG00000059131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 24641025)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24794467
GRCz11 17 24812868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAGACGACCAAAGCCCAGCACACCTGCAAATACAAGCCTATTGCAGG[T/C]GAATAAGTGCATGGCGCCCTCTAGTCGTGGTACAGCAGCACTGCTGGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link