zgc:162320

Ensembl ID:
ENSDARG00000059110
ZFIN ID:
ZDB-GENE-070424-68
Description:
vasodilator-stimulated phosphoprotein [Source:RefSeq peptide;Acc:NP_001103922]
Human Orthologue:
VASP
Human Description:
vasodilator-stimulated phosphoprotein [Source:HGNC Symbol;Acc:12652]
Mouse Orthologue:
Vasp
Mouse Description:
vasodilator-stimulated phosphoprotein Gene [Source:MGI Symbol;Acc:MGI:109268]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21622 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126231 Nonsense 309 365 9 12
Genomic Location (Zv9):
Chromosome 10 (position 16154)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 325300
GRCz11 10 326945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAAGACTCAAGACAAGAGTCCAGTGTCTCCTGCAACTGCGGCTCCGT[T/A]GAGCAGGTATCATATTCTTCAGTCGAGTGTGTAGTTTTGTGCATCTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link