si:dkey-276i5.1

Ensembl ID:
ENSDARG00000059070
ZFIN ID:
ZDB-GENE-030131-9174
Description:
Si:dkey-276i5.1 protein [Source:UniProtKB/TrEMBL;Acc:Q4V9I4]
Human Orthologue:
GARS
Human Description:
glycyl-tRNA synthetase [Source:HGNC Symbol;Acc:4162]
Mouse Orthologue:
Gars
Mouse Description:
glycyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2449057]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13782 Nonsense Available for shipment Available now
sa37871 Nonsense Mutation detected in F1 DNA During 2018
sa24482 Essential Splice Site Available for shipment Available now
sa24483 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082082 Nonsense 286 764 7 17
Genomic Location (Zv9):
Chromosome 24 (position 21151379)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20398508
GRCz11 24 20542927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGGATAACTACACTCAGCAGGAGTTGRCYGATTTGTTTGYGCAATA[C/A]AAYGTCAAGTCTCCCAGCACAGGAAATGATCTCACACCTCCAATYTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082082 Nonsense 318 764 7 17
Genomic Location (Zv9):
Chromosome 24 (position 21151473)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20398602
GRCz11 24 20543021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATTCAACCTAATGTTCCAGACCTCCATTGGGCCTGGAGGCAACATG[C/T]AAGGGTATGTTGGACACCAGCAGATTAAATCCTGTAACTTAAAAATATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082082 Essential Splice Site 319 764 8 17
Genomic Location (Zv9):
Chromosome 24 (position 21151573)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20398702
GRCz11 24 20543121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTAAGAAAACCCGATGCATTATATATGTGGGTGTGTTACTTCCACA[G/A]CTATTTAAGGCCAGAAACCGCTCAGGGAATCTTCCTCAACTTCAAGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082082 Nonsense 719 764 16 17
Genomic Location (Zv9):
Chromosome 24 (position 21161315)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20408444
GRCz11 24 20552863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATAAAAATCCCCACACAGCCACTCTGAGAGACCGCGACTCCATGAGA[C/T]AGATCAGGGCTGAGGTAAAAGCCCAAAATTACTCTTGGCAAAAAATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link