
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:56039
- Ensembl ID:
- ENSDARG00000059059
- ZFIN ID:
- ZDB-GENE-030131-7832
- Description:
- Protein EMSY [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUV7]
- Human Orthologue:
- C11orf30
- Human Description:
- chromosome 11 open reading frame 30 [Source:HGNC Symbol;Acc:18071]
- Mouse Orthologue:
- 2210018M11Rik
- Mouse Description:
- RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34801 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34801
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101661 | Essential Splice Site | 518 | 1150 | 9 | 18 |
- Genomic Location (Zv9):
- Chromosome 10 (position 356905)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 291800 GRCz11 10 291800 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCTGGCCACGCTCGGGGGCAAGATCATCACCACCAGCATGGTGTCCGG[T/C]AAGTGTCATTACCACACTGTCATTAATTAGTGACTTACCATATTTATCAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Atopic dermatitis: A common variant on chromosome 11q13 is associated with atopic dermatitis. (View Study)
- Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
- Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: