zgc:56039

Ensembl ID:
ENSDARG00000059059
ZFIN ID:
ZDB-GENE-030131-7832
Description:
Protein EMSY [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUV7]
Human Orthologue:
C11orf30
Human Description:
chromosome 11 open reading frame 30 [Source:HGNC Symbol;Acc:18071]
Mouse Orthologue:
2210018M11Rik
Mouse Description:
RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34801 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101661 Essential Splice Site 518 1150 9 18
Genomic Location (Zv9):
Chromosome 10 (position 356905)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 291800
GRCz11 10 291800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGGCCACGCTCGGGGGCAAGATCATCACCACCAGCATGGTGTCCGG[T/C]AAGTGTCATTACCACACTGTCATTAATTAGTGACTTACCATATTTATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: A common variant on chromosome 11q13 is associated with atopic dermatitis. (View Study)
  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link