vipr1

Ensembl ID:
ENSDARG00000059058
ZFIN ID:
ZDB-GENE-050311-6
Description:
vasoactive intestinal peptide receptor 1 [Source:RefSeq peptide;Acc:NP_001013371]
Human Orthologues:
GHRHR, SCTR
Human Descriptions:
growth hormone releasing hormone receptor [Source:HGNC Symbol;Acc:4266]
secretin receptor [Source:HGNC Symbol;Acc:10608]
Mouse Orthologues:
Ghrhr, Sctr
Mouse Descriptions:
growth hormone releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95710]
secretin receptor Gene [Source:MGI Symbol;Acc:MGI:2441720]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39446 Nonsense Mutation detected in F1 DNA During 2018
sa45828 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082062   None 422 1 13
ENSDART00000143759 Nonsense 9 446 1 13
Genomic Location (Zv9):
Chromosome 24 (position 21416461)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20663590
GRCz11 24 20808009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATTAACAAAGAAAACGCAACGATGGACGCCTCAAAAGTGGTTTTAT[T/A]GGCTTCAGCGTTTGGCTTCGTGTTTTCTCCGGTAAGTGTTTGTTTTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082062 Essential Splice Site 25 422 2 13
ENSDART00000143759 Essential Splice Site 49 446 2 13
Genomic Location (Zv9):
Chromosome 24 (position 21387223)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20634352
GRCz11 24 20778771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCAAGAGCGAGGTGTGAGAATAAAACAGCAGGAAATGTCACATCAG[G/A]TAATTTTCAAGAAACAATGTTGCTTTGTGCCATTTTCATAGTCATTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link