zgc:162495

Ensembl ID:
ENSDARG00000059053
ZFIN ID:
ZDB-GENE-070424-71
Description:
solute carrier family 13 member 4 [Source:RefSeq peptide;Acc:NP_001083020]
Human Orthologue:
SLC13A4
Human Description:
solute carrier family 13 (sodium/sulfate symporters), member 4 [Source:HGNC Symbol;Acc:15827]
Mouse Orthologue:
Slc13a4
Mouse Description:
solute carrier family 13 (sodium/sulfate symporters), member 4 Gene [Source:MGI Symbol;Acc:MGI:24423

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12751 Nonsense Available for shipment Available now
sa12487 Essential Splice Site Available for shipment Available now
sa40211 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16821 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089566   None 206 None 6
ENSDART00000101419   268 603 7 15
ENSDART00000129252 Nonsense 275 610 7 15
ENSDART00000136962   112 200 4 7
Genomic Location (Zv9):
Chromosome 4 (position 4691904)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4810085
GRCz11 4 4818655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGCCTCATCACCATCACCGGCACCTCCACCAATCTCATTTTCGCTGAA[C/T]AGTTCAACAAGTACGNNNGTAGCATCCTGGACATCATTTTTCTAATGTTCRCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089566   None 206 None 6
ENSDART00000101419 Essential Splice Site 271 603 8 15
ENSDART00000129252 Essential Splice Site 278 610 8 15
ENSDART00000136962 Essential Splice Site 115 200 5 7
Genomic Location (Zv9):
Chromosome 4 (position 4695971)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4814152
GRCz11 4 4822722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTATANNNNNNNNNNNNNNNNNNNNTTTGCTATGAAATGTGTTTTTC[A/T]GTCGTTACCCAGAAGCAAAAGTCATCAACTTCGGYACGTGGTTCATCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089566   None 206 None 6
ENSDART00000101419 Essential Splice Site 311 603 8 15
ENSDART00000129252 Essential Splice Site 318 610 8 15
ENSDART00000136962 Essential Splice Site 155 200 5 7
Genomic Location (Zv9):
Chromosome 4 (position 4696093)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4814274
GRCz11 4 4822844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGATTCTCACCTGGATCTGGCTGCACTTTTTATTCCTGGGATGCAA[G/A]TAAGAATAAAAGAGAGTGTTTTTGATCTTGAGTTTGTGAAAGGATATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089566   None 206 None 6
ENSDART00000101419 Essential Splice Site 415 603 12 15
ENSDART00000129252 Essential Splice Site 422 610 12 15
ENSDART00000136962   None 200 None 7
Genomic Location (Zv9):
Chromosome 4 (position 4699590)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4817771
GRCz11 4 4826341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRTGAACGTTCTGCTGGTCCTAATCTGTAACTGTGTCATTGTGTCTGTGC[A/G]GATGATGAGGATGAGGATGARGAACAGGATCCGCTGGCTCCAATGATCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link