zgc:63480

Ensembl ID:
ENSDARG00000059035
ZFIN IDs:
ZDB-GENE-030131-5767, ZDB-GENE-030131-5767
Description:
hypothetical protein LOC327556 [Source:RefSeq peptide;Acc:NP_956120]
Human Orthologue:
POR
Human Description:
P450 (cytochrome) oxidoreductase [Source:HGNC Symbol;Acc:9208]
Mouse Orthologue:
Por
Mouse Description:
P450 (cytochrome) oxidoreductase Gene [Source:MGI Symbol;Acc:MGI:97744]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39022 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010190 Nonsense 24 676 1 15
ENSDART00000082031 Nonsense 20 268 2 11
Genomic Location (Zv9):
Chromosome 15 (position 1869439)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1916561
GRCz11 15 1880133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACAGCCCACAGAGATGATGGAGGAGGACGAGCCCTTCTTCAGTAACT[T/A]GGACCTTTTCCTCTTCTCTCTCATTGCTGGCCTGCTGATCTATTGGCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link