zgc:123217

Ensembl ID:
ENSDARG00000059026
ZFIN ID:
ZDB-GENE-051113-188
Description:
hypothetical protein LOC641414 [Source:RefSeq peptide;Acc:NP_001032480]
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35191 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21999 Nonsense Available for shipment Available now
sa22000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082023 Essential Splice Site 171 325 3 5
ENSDART00000106650 Essential Splice Site 172 326 4 6
Genomic Location (Zv9):
Chromosome 12 (position 4722528)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4005250
GRCz11 12 4042015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGCACATCCTGCTGGGCCACGGGTTGGGGAAACATCGGCAAAGACC[G/A]TGAGTTTTCATTGATTATAATCCTTTAATATAAATGTTACATAATTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082023 Nonsense 255 325 5 5
ENSDART00000106650 Nonsense 256 326 6 6
Genomic Location (Zv9):
Chromosome 12 (position 4724176)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4006898
GRCz11 12 4043663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGGCATCACGAGTTATGGGACGAGTGCGGGCTGCGCTGTGGGAGCTTA[T/A]CCAGACGTGTATTCACGAGTCTCTGAGTTTCAGTCTTGGATCAAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082023 Nonsense 309 325 5 5
ENSDART00000106650 Nonsense 310 326 6 6
Genomic Location (Zv9):
Chromosome 12 (position 4724336)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4007058
GRCz11 12 4043823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATGCTCAAACACAGCCTCACCGCATTTCACATTCATCTCTAATTTC[A/T]GAATTCTCTTCATTACACTAATCTCAAGCTTCCTCATACTCATGGTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link