si:dkey-83k24.4

Ensembl ID:
ENSDARG00000058990
ZFIN IDs:
ZDB-GENE-030616-62, ZDB-GENE-070424-281
Description:
UDP-galactose translocator [Source:RefSeq peptide;Acc:NP_001123545]
Human Orthologue:
SLC35A2
Human Description:
solute carrier family 35 (UDP-galactose transporter), member A2 [Source:HGNC Symbol;Acc:11022]
Mouse Orthologue:
Slc35a2
Mouse Description:
solute carrier family 35 (UDP-galactose transporter), member A2 Gene [Source:MGI Symbol;Acc:MGI:1345

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15127 Nonsense Available for shipment Available now
sa34305 Nonsense Mutation detected in F1 DNA During 2018
sa18618 Nonsense Available for shipment Available now
sa16989 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081983 Nonsense 79 395 2 6
ENSDART00000131215 Nonsense 79 374 2 4
Genomic Location (Zv9):
Chromosome 8 (position 9498923)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8915505
GRCz11 8 8954090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACCACATCGGCTGTGGTGATGGCAGAAGTTCTTAAAGTCATCACCTG[T/A]CTGTTCATCATCCTKATACARAAGAGAGGTGCGTTCACTAGACACTMCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081983 Nonsense 183 395 4 6
ENSDART00000131215 Nonsense 183 374 4 4
Genomic Location (Zv9):
Chromosome 8 (position 9501934)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8918516
GRCz11 8 8957101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTCTCTGGTGCTGCTGTTCGCCGGTGTGGCCATCGTCCAGGTGGAG[C/T]AAGAGAGCGGCAAGCAGAAGGAGGCCGTGACTGCGGCCAACCAGAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081983 Nonsense 199 395 4 6
ENSDART00000131215 Nonsense 199 374 4 4
Genomic Location (Zv9):
Chromosome 8 (position 9501984)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8918566
GRCz11 8 8957151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGAGAGCGGCAAGCAGAAGGAGGCCGTGACTGCGGCCAACCAGAACTA[C/A]TTCAAGGGTCTGCTGTCCGTCATCATCTCCTGCCTCTCCTCGGGCTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081983 Nonsense 221 395 4 6
ENSDART00000131215 Nonsense 221 374 4 4
Genomic Location (Zv9):
Chromosome 8 (position 9502048)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8918630
GRCz11 8 8957215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCGTCATCATCTCCTGCCTCTCCTCGGGCTTCGCCGGCGTCTACTTC[G/T]ARAAGATCCTKAAGGGCAGCTCGGCGTCAGTGTGGATGAGGAACATCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link