zgc:123253

Ensembl ID:
ENSDARG00000058962
ZFIN ID:
ZDB-GENE-051030-63
Description:
thioredoxin-like protein 4B [Source:RefSeq peptide;Acc:NP_001032200]
Human Orthologue:
TXNL4B
Human Description:
thioredoxin-like 4B [Source:HGNC Symbol;Acc:26041]
Mouse Orthologue:
Txnl4b
Mouse Description:
thioredoxin-like 4B Gene [Source:MGI Symbol;Acc:MGI:2443724]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5654 Nonsense F2 line generated During 2018
sa2009 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa5654
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081945 Nonsense 69 149 2 4
ENSDART00000109083 Nonsense 69 149 2 3
ENSDART00000081945 Nonsense 69 149 2 4
ENSDART00000109083 Nonsense 69 149 2 3

The following transcripts of ENSDARG00000058962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 390270)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 520394
GRCz11 1 515573
KASP Assay ID:
554-3386.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAATATGGCCAGTATTTATCTGGTRGATGTCGACTCAGCTCCAGTTTA[C/A]ASCAGATACTTTGACATCAGCTTTATTCCCTCCACCGTGTTCTTCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2009
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081945 Nonsense 69 149 2 4
ENSDART00000109083 Nonsense 69 149 2 3
ENSDART00000081945 Nonsense 69 149 2 4
ENSDART00000109083 Nonsense 69 149 2 3

The following transcripts of ENSDARG00000058962 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 390270)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 520394
GRCz11 1 515573
KASP Assay ID:
554-3386.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAATATGGCCAGTATTTATCTGGTGGATGTCGACTCAGCTCCAGTTTA[C/A]ASCAGATACTTTGACATCAGCTTTATTCCCTCCACCGTGTTCTTCTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link